- buster 1.2.12+dfsg-2
NGSFILTER(1) | OBITools | NGSFILTER(1) |
NAME¶
ngsfilter - description of ngsfilterTo distinguish between sequences from different PCR products pooled in the same sequencing library, pairs of small DNA sequences (call tags, see the oligoTag command and its associated paper for more informations on the design of such tags) can be concatenated to the PCR primers.
ngsfilter takes as input sequence record files and a file describing the DNA tags and primers sequences used for each PCR sample. ngsfilter allows to demultiplex sequence records file by identifying these DNA tags and the primers.
ngsfilter requires a sample description file containing the description of the primers and tags associated to each sample (specified by option -t). The sample description file is a text file where each line describes one sample. Columns are separated by space or tab characters. Lines beginning with the ‘#’ character will be considered as commentary lines and will simply be ignored by ngsfilter.
Here is an example of a sample description file:
#exp sample tags forward_primer reverse_primer extra_information gh 01_11a cacgcagtc:cacgcatcg GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=1; gh 01_12a cacgcatcg:cacgcagtc GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=2; gh 01_21a cacgcgcat:cacgctact GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=2; extraction=1; gh 01_22a cacgctact:cacgcgcat GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=2; extraction=2; gh 02_11a cacgctgag:cacgtacga GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=1; gh 02_12a cacgtacga:cacgctgag GGGCAATCCTGAGCCAA CCATTGAGTCTCTGCACCTATC F @ community=Festuca; bucket=1; extraction=2;
The results consist of sequence records, printed on the standard output, with their sequence trimmed of the primers and tags and annotated with the corresponding experiment and sample (and possibly some extra informations). Sequences for which the tags and primers have not been well identified, and which are thus unassigned to any sample, are stored in a file if option -u is specified and tagged as erroneous sequences (error attribute) by ngsfilter.
NGSFILTER SPECIFIC OPTIONS¶
- -t, --tag-list
- Used to specify the file containing the samples description (with tags, primers, sample names,…)
- -u, --unidentified
- Filename used to store the sequences unassigned to any sample
- -e, --error
- Used to specify the number of errors allowed for matching primers [default = 2]
OPTIONS TO SPECIFY INPUT FORMAT¶
Restrict the analysis to a sub-part of the input file¶
- --skip <N>
- The N first sequence records of the file are discarded from the analysis and not reported to the output file
- --only <N>
- Only the N next sequence records of the file are analyzed. The following sequences in the file are neither analyzed, neither reported to the output file. This option can be used conjointly with the –skip option.
Sequence annotated format¶
- --genbank
- Input file is in genbank format.
- --embl
- Input file is in embl format.
fasta related format¶
- --fasta
- Input file is in fasta format (including OBITools fasta extensions).
fastq related format¶
- --sanger
- Input file is in Sanger fastq format (standard fastq used by HiSeq/MiSeq sequencers).
- --solexa
- Input file is in fastq format produced by Solexa (Ga IIx) sequencers.
ecoPCR related format¶
- --ecopcr
- Input file is in ecoPCR format.
- --ecopcrdb
- Input is an ecoPCR database.
Specifying the sequence type¶
- --nuc
- Input file contains nucleic sequences.
- --prot
- Input file contains protein sequences.
OPTIONS TO SPECIFY OUTPUT FORMAT¶
Standard output format¶
- --fasta-output
- Output sequences in OBITools fasta format
- --fastq-output
- Output sequences in Sanger fastq format
Generating an ecoPCR database¶
- --ecopcrdb-output=<PREFIX_FILENAME>
- Creates an ecoPCR database from sequence records results
Miscellaneous option¶
- --uppercase
- Print sequences in upper case (default is lower case)
COMMON OPTIONS¶
- -h, --help
- Shows this help message and exits.
- --DEBUG
- Sets logging in debug mode.
NGSFILTER ADDED SEQUENCE ATTRIBUTES¶
- avg_quality
- complemented
- cut
- direction
- error
- experiment
- forward_match
- forward_primer
- forward_score
- forward_tag
- head_quality
- mid_quality
- partial
- reverse_match
- reverse_primer
- reverse_score
- reverse_tag
- sample
- seq_length
- seq_length_ori
- status
- tail_quality
AUTHOR¶
The OBITools Development Team - LECACOPYRIGHT¶
2019 - 2015, OBITool Development TeamJanuary 28, 2019 | 1.02 12 |