| Bio::PrimarySeq(3pm) | User Contributed Perl Documentation | Bio::PrimarySeq(3pm) |
NAME¶
Bio::PrimarySeq - Bioperl lightweight sequence object
SYNOPSIS¶
# Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
# make from memory
$seqobj = Bio::PrimarySeq->new (
-seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'X78121',
-alphabet => 'dna',
-is_circular => 1,
);
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, "\n";
# read from file
$inputstream = Bio::SeqIO->new(
-file => "myseq.fa",
-format => 'Fasta',
);
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
DESCRIPTION¶
PrimarySeq is a lightweight sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.
Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation
The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
FEEDBACK¶
Mailing Lists¶
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support¶
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.
Reporting Bugs¶
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
AUTHOR - Ewan Birney¶
Email birney@ebi.ac.uk
APPENDIX¶
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
new¶
Title : new
Usage : $seqobj = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Note that you can provide an empty sequence string. However, in
this case you MUST specify the type of sequence you wish to
initialize by the parameter -alphabet. See alphabet() for possible
values.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-ref_to_seq => ... or reference to a sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-version => version number
-namespace => the namespace for the accession
-authority => the authority for the namespace
-description => description text
-desc => alias for description
-alphabet => skip alphabet guess and set it to dna, rna or protein
-id => alias for display id
-is_circular => boolean to indicate that sequence is circular
-direct => boolean to directly set sequences. The next time -seq,
seq() or -ref_to_seq is use, the sequence will not be
validated. Be careful with this...
-nowarnonempty => boolean to avoid warning when sequence is empty
seq¶
Title : seq
Usage : $string = $seqobj->seq();
Function: Get or set the sequence as a string of letters. The case of
the letters is left up to the implementer. Suggested cases are
upper case for proteins and lower case for DNA sequence (IUPAC
standard), but you should not rely on this. An error is thrown if
the sequence contains invalid characters: see validate_seq().
Returns : A scalar
Args : - Optional new sequence value (a string) to set
- Optional alphabet (it is guessed by default)
validate_seq¶
Title : validate_seq
Usage : if(! $seqobj->validate_seq($seq_str) ) {
print "sequence $seq_str is not valid for an object of
alphabet ",$seqobj->alphabet, "\n";
}
Function: Test that the given sequence is valid, i.e. contains only valid
characters. The allowed characters are all letters (A-Z) and '-','.',
'*','?','=' and '~'. Spaces are not valid. Note that this
implementation does not take alphabet() into account and that empty
sequences are considered valid.
Returns : 1 if the supplied sequence string is valid, 0 otherwise.
Args : - Sequence string to be validated
- Boolean to optionally throw an error if the sequence is invalid
subseq¶
Title : subseq
Usage : $substring = $seqobj->subseq(10,40);
$substring = $seqobj->subseq(10,40,'nogap');
$substring = $seqobj->subseq(-start=>10, -end=>40, -replace_with=>'tga');
$substring = $seqobj->subseq($location_obj);
$substring = $seqobj->subseq($location_obj, -nogap => 1);
Function: Return the subseq from start to end, where the first sequence
character has coordinate 1 number is inclusive, ie 1-2 are the
first two characters of the sequence. The given start coordinate
has to be larger than the end, even if the sequence is circular.
Returns : a string
Args : integer for start position
integer for end position
OR
Bio::LocationI location for subseq (strand honored)
Specify -NOGAP=>1 to return subseq with gap characters removed
Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
with $new_subseq in the sequence object
length¶
Title : length
Usage : $len = $seqobj->length();
Function: Get the stored length of the sequence in number of symbols (bases
or amino acids). In some circumstances, you can also set this attribute:
1. For empty sequences, you can set the length to anything you want:
my $seqobj = Bio::PrimarySeq->new( -length => 123 );
my $len = $seqobj->len; # 123
2. To save memory when using very long sequences, you can set the
length of the sequence to the length of the sequence (and nothing
else):
my $seqobj = Bio::PrimarySeq->new( -seq => 'ACGT...' ); # 1 Mbp sequence
# process $seqobj... then after you're done with it
$seqobj->length($seqobj->length);
$seqobj->seq(undef); # free memory!
my $len = $seqobj->len; # 1 Mbp
Note that if you set seq() to a value other than undef at any time,
the length attribute will be reset.
Returns : integer representing the length of the sequence.
Args : Optionally, the value on set
display_id¶
Title : display_id or display_name
Usage : $id_string = $seqobj->display_id();
Function: Get or set the display id, aka the common name of the sequence object.
The semantics of this is that it is the most likely string to
be used as an identifier of the sequence, and likely to have
"human" readability. The id is equivalent to the ID field of
the GenBank/EMBL databanks and the id field of the
Swissprot/sptrembl database. In fasta format, the >(\S+) is
presumed to be the id, though some people overload the id to
embed other information. Bioperl does not use any embedded
information in the ID field, and people are encouraged to use
other mechanisms (accession field for example, or extending
the sequence object) to solve this.
With the new Bio::DescribeableI interface, display_name aliases
to this method.
Returns : A string for the display ID
Args : Optional string for the display ID to set
accession_number¶
Title : accession_number or object_id
Usage : $unique_key = $seqobj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implementation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should
return "unknown".
[Note this method name is likely to change in 1.3]
With the new Bio::IdentifiableI interface, this is aliased
to object_id
Returns : A string
Args : A string (optional) for setting
primary_id¶
Title : primary_id
Usage : $unique_key = $seqobj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage their
own object ids in a way the implementation can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method
should return a stringified memory location.
Returns : A string
Args : A string (optional, for setting)
alphabet¶
Title : alphabet
Usage : if( $seqobj->alphabet eq 'dna' ) { # Do something }
Function: Get/set the alphabet of sequence, one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called <type> because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no alphabet specified it
has to guess.
Args : optional string to set : 'dna' | 'rna' | 'protein'
desc¶
Title : desc or description
Usage : $seqobj->desc($newval);
Function: Get/set description of the sequence.
'description' is an alias for this for compliance with the
Bio::DescribeableI interface.
Returns : value of desc (a string)
Args : newvalue (a string or undef, optional)
can_call_new¶
Title : can_call_new Usage : Function: Example : Returns : true Args :
id¶
Title : id Usage : $id = $seqobj->id(); Function: This is mapped on display_id Example : Returns : Args :
is_circular¶
Title : is_circular
Usage : if( $seqobj->is_circular) { # Do something }
Function: Returns true if the molecule is circular
Returns : Boolean value
Args : none
Methods for Bio::IdentifiableI compliance¶
object_id¶
Title : object_id
Usage : $string = $seqobj->object_id();
Function: Get or set a string which represents the stable primary identifier
in this namespace of this object. For DNA sequences this
is its accession_number, similarly for protein sequences.
This is aliased to accession_number().
Returns : A scalar
Args : Optional object ID to set.
version¶
Title : version
Usage : $version = $seqobj->version();
Function: Get or set a number which differentiates between versions of
the same object. Higher numbers are considered to be
later and more relevant, but a single object described
the same identifier should represent the same concept.
Returns : A number
Args : Optional version to set.
authority¶
Title : authority
Usage : $authority = $seqobj->authority();
Function: Get or set a string which represents the organisation which
granted the namespace, written as the DNS name of the
organisation (eg, wormbase.org).
Returns : A scalar
Args : Optional authority to set.
namespace¶
Title : namespace
Usage : $string = $seqobj->namespace();
Function: Get or set a string representing the name space this identifier
is valid in, often the database name or the name describing the
collection.
Returns : A scalar
Args : Optional namespace to set.
Methods for Bio::DescribableI compliance¶
This comprises of display_name and description.
display_name¶
Title : display_name
Usage : $string = $seqobj->display_name();
Function: Get or set a string which is what should be displayed to the user.
The string should have no spaces (ideally, though a cautious
user of this interface would not assume this) and should be
less than thirty characters (though again, double checking
this is a good idea).
This is aliased to display_id().
Returns : A string for the display name
Args : Optional string for the display name to set.
description¶
Title : description
Usage : $string = $seqobj->description();
Function: Get or set a text string suitable for displaying to the user a
description. This string is likely to have spaces, but
should not have any newlines or formatting - just plain
text. The string should not be greater than 255 characters
and clients can feel justified at truncating strings at 255
characters for the purposes of display.
This is aliased to desc().
Returns : A string for the description
Args : Optional string for the description to set.
Methods Inherited from Bio::PrimarySeqI¶
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI
revcom¶
Title : revcom
Usage : $rev = $seqobj->revcom();
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom".
The id is the same id as the original sequence, and the
accession number is also identical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions.
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
trunc¶
Title : trunc Usage : $subseq = $myseq->trunc(10,100); Function: Provides a truncation of a sequence, Returns : A fresh Bio::SeqI implementing object. Args : Numbers for the start and end positions
Internal methods¶
These are internal methods to PrimarySeq
_guess_alphabet¶
Title : _guess_alphabet
Usage :
Function: Automatically guess and set the type of sequence: dna, rna, protein
or '' if the sequence was empty. This method first removes dots (.),
dashes (-) and question marks (?) before guessing the alphabet
using the IUPAC conventions for ambiguous residues. Since the DNA and
RNA characters are also valid characters for proteins, there is
no foolproof way of determining the right alphabet. This is our best
guess only!
Returns : string 'dna', 'rna', 'protein' or ''.
Args : none
| 2026-06-21 | perl v5.40.1 |