| Bio::SeqFeature::Primer(3pm) | User Contributed Perl Documentation | Bio::SeqFeature::Primer(3pm) |
NAME¶
Bio::SeqFeature::Primer - Primer Generic SeqFeature
SYNOPSIS¶
use Bio::SeqFeature::Primer;
# Primer object with explicitly-defined sequence object or sequence string
my $primer = Bio::SeqFeature::Primer->new( -seq => 'ACGTAGCT' );
$primer->display_name('test_id');
print "These are the details of the primer:\n".
"Name: ".$primer->display_name."\n".
"Tag: ".$primer->primary_tag."\n". # always 'Primer'
"Sequence: ".$primer->seq->seq."\n".
"Tm: ".$primer->Tm."\n\n"; # melting temperature
# Primer object with implicit sequence object
# It is a lighter approach for when the primer location on a template is known
use Bio::Seq;
my $template = Bio::Seq->new( -seq => 'ACGTAGCTCTTTTCATTCTGACTGCAACG' );
$primer = Bio::SeqFeature::Primer->new( -start => 1, -end =>5, -strand => 1 );
$template->add_SeqFeature($primer);
print "Primer sequence is: ".$primer->seq->seq."\n";
# Primer sequence is 'ACGTA'
DESCRIPTION¶
This module handles PCR primer sequences. The Bio::SeqFeature::Primer object is a Bio::SeqFeature::Subseq object that can additionally contain a primer sequence and its coordinates on a template sequence. The primary_tag() for this object is 'Primer'. A method is provided to calculate the melting temperature Tm of the primer. Bio::SeqFeature::Primer objects are useful to build Bio::Seq::PrimedSeq amplicon objects such as the ones returned by Bio::Tools::Primer3.
FEEDBACK¶
Mailing Lists¶
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support¶
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.
Reporting Bugs¶
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
https://github.com/bioperl/bioperl-live/issues
AUTHOR¶
Rob Edwards, redwards@utmem.edu
The original concept and much of the code was written by Chad Matsalla, bioinformatics1@dieselwurks.com
APPENDIX¶
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
new()¶
Title : new()
Usage : my $primer = Bio::SeqFeature::Primer( -seq => $seq_object );
Function: Instantiate a new Bio::SeqFeature::Primer object
Returns : A Bio::SeqFeature::Primer object
Args : -seq , a sequence object or a sequence string (optional)
-id , the ID to give to the primer sequence, not feature (optional)
Tm()¶
Title : Tm()
Usage : my $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
Function: Calculate the Tm (melting temperature) of the primer
Returns : A scalar containing the Tm.
Args : -salt : set the Na+ concentration on which to base the calculation
(default=0.05 molar).
: -oligo : set the oligo concentration on which to base the
calculation (default=0.00000025 molar).
Notes : Calculation of Tm as per Allawi et. al Biochemistry 1997
36:10581-10594. Also see documentation at
http://www.idtdna.com/Scitools/Scitools.aspx as they use this
formula and have a couple nice help pages. These Tm values will be
about are about 0.5-3 degrees off from those of the idtdna web tool.
I don't know why.
This was suggested by Barry Moore (thanks!). See the discussion on
the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating
the PrimerTM"
Tm_estimate¶
Title : Tm_estimate
Usage : my $tm = $primer->Tm_estimate(-salt => 0.05);
Function: Estimate the Tm (melting temperature) of the primer
Returns : A scalar containing the Tm.
Args : -salt set the Na+ concentration on which to base the calculation.
Notes : This is only an estimate of the Tm that is kept in for comparative
reasons. You should probably use Tm instead!
This Tm calculations are taken from the Primer3 docs: They are
based on Bolton and McCarthy, PNAS 84:1390 (1962)
as presented in Sambrook, Fritsch and Maniatis,
Molecular Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
where [Na+] is the molar sodium concentration, %GC is the
%G+C of the sequence, and length is the length of the sequence.
However.... I can never get this calculation to give me the same result
as primer3 does. Don't ask why, I never figured it out. But I did
want to include a Tm calculation here because I use these modules for
other things besides reading primer3 output.
The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
and this calculation is saved as $primer->Tm so you can get both and
average them!
primary_tag, source_tag, location, start, end, strand...¶
The documentation of Bio::SeqFeature::Generic describes all the methods that Bio::SeqFeature::Primer object inherit.
| 2026-06-21 | perl v5.40.1 |