Scroll to navigation

Bio::Perl(3pm) User Contributed Perl Documentation Bio::Perl(3pm)

NAME

Bio::Perl - Functional access to BioPerl for people who don't know objects

VERSION

version 1.7.4

SYNOPSIS

  use Bio::Perl;
  # will guess file format from extension
  $seq_object = read_sequence($filename);
  # forces genbank format
  $seq_object = read_sequence($filename,'genbank');
  # reads an array of sequences
  @seq_object_array = read_all_sequences($filename,'fasta');
  # sequences are Bio::Seq objects, so the following methods work
  # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'
  print "Sequence name is ",$seq_object->display_id,"\n";
  print "Sequence acc  is ",$seq_object->accession_number,"\n";
  print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
  # get the whole sequence as a single string
  $sequence_as_a_string = $seq_object->seq();
  # writing sequences
  write_sequence(">$filename",'genbank',$seq_object);
  write_sequence(">$filename",'genbank',@seq_object_array);
  # making a new sequence from just a string
  $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
      "myname","AL12232");
  # getting a sequence from a database (assumes internet connection)
  $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
  $seq_object = get_sequence('embl',"AI129902");
  $seq_object = get_sequence('genbank',"AI129902");
  # BLAST a sequence (assumes an internet connection)
  $blast_report = blast_sequence($seq_object);
  write_blast(">blast.out",$blast_report);

DESCRIPTION

Easy first time access to BioPerl via functions.

read_sequence

 Title   : read_sequence
 Usage   : $seq = read_sequence('sequences.fa')
           $seq = read_sequence($filename,'genbank');
           # pipes are fine
           $seq = read_sequence("my_fetching_program $id |",'fasta');
 Function: Reads the top sequence from the file. If no format is given, it will
           try to guess the format from the filename. If a format is given, it
           forces that format. The filename can be any valid perl open() string
           - in particular, you can put in pipes
 Returns : A Bio::Seq object. A quick synopsis:
           $seq_object->display_id - name of the sequence
           $seq_object->seq        - sequence as a string
 Args    : Two strings, first the filename - any Perl open() string is ok
           Second string is the format, which is optional

For more information on Seq objects see Bio::Seq.

read_all_sequences

 Title   : read_all_sequences
 Usage   : @seq_object_array = read_all_sequences($filename);
           @seq_object_array = read_all_sequences($filename,'genbank');
 Function: Just as the function above, but reads all the sequences in the
           file and loads them into an array.
           For very large files, you will run out of memory. When this
           happens, you've got to use the SeqIO system directly (this is
           not so hard! Don't worry about it!).
 Returns : array of Bio::Seq objects
 Args    : two strings, first the filename (any open() string is ok)
           second the format (which is optional)

See Bio::SeqIO and Bio::Seq for more information

write_sequence

 Title   : write_sequence
 Usage   : write_sequence(">new_file.gb",'genbank',$seq)
           write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
 Function: writes sequences in the specified format
 Returns : true
 Args    : filename as a string, must provide an open() output file
           format as a string
           one or more sequence objects

new_sequence

 Title   : new_sequence
 Usage   : $seq_obj = new_sequence("GATTACA", "kino-enzyme");
 Function: Construct a sequency object from sequence string
 Returns : A Bio::Seq object
 Args    : sequence string
           name string (optional, default "no-name-for-sequence")
           accession - accession number (optional, no default)

blast_sequence

 Title   : blast_sequence
 Usage   : $blast_result = blast_sequence($seq)
           $blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
 Function: If the computer has Internet accessibility, blasts
           the sequence using the NCBI BLAST server against nrdb.
           It chooses the flavour of BLAST on the basis of the sequence.
           This function uses Bio::Tools::Run::RemoteBlast, which itself
           use Bio::SearchIO - as soon as you want to know more, check out
           these modules
 Returns : Bio::Search::Result::GenericResult.pm
 Args    : Either a string of protein letters or nucleotides, or a
           Bio::Seq object

write_blast

 Title   : write_blast
 Usage   : write_blast($filename,$blast_report);
 Function: Writes a BLAST result object (or more formally
           a SearchIO result object) out to a filename
           in BLAST-like format
 Returns : none
 Args    : filename as a string
           Bio::SearchIO::Results object

get_sequence

 Title   : get_sequence
 Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
 Function: If the computer has Internet access this method gets
           the sequence from Internet accessible databases. Currently
           this supports Swissprot ('swiss'), EMBL ('embl'), GenBank
           ('genbank'), GenPept ('genpept'), and RefSeq ('refseq').
           Swissprot and EMBL are more robust than GenBank fetching.
           If the user is trying to retrieve a RefSeq entry from
           GenBank/EMBL, the query is silently redirected.
 Returns : A Bio::Seq object
 Args    : database type - one of swiss, embl, genbank, genpept, or
           refseq

translate

 Title   : translate
 Usage   : $seqobj = translate($seq_or_string_scalar)
 Function: translates a DNA sequence object OR just a plain
           string of DNA to amino acids
 Returns : A Bio::Seq object
 Args    : Either a sequence object or a string of
           just DNA sequence characters

translate_as_string

 Title   : translate_as_string
 Usage   : $seqstring = translate_as_string($seq_or_string_scalar)
 Function: translates a DNA sequence object OR just a plain
           string of DNA to amino acids
 Returns : A string of just amino acids
 Args    : Either a sequence object or a string of
           just DNA sequence characters

reverse_complement

 Title   : reverse_complement
 Usage   : $seqobj = reverse_complement($seq_or_string_scalar)
 Function: reverse complements a string or sequence argument
           producing a Bio::Seq - if you want a string, you
           can use reverse_complement_as_string
 Returns : A Bio::Seq object
 Args    : Either a sequence object or a string of
           just DNA sequence characters

revcom

 Title   : revcom
 Usage   : $seqobj = revcom($seq_or_string_scalar)
 Function: reverse complements a string or sequence argument
           producing a Bio::Seq - if you want a string, you
           can use reverse_complement_as_string
           This is an alias for reverse_complement
 Returns : A Bio::Seq object
 Args    : Either a sequence object or a string of
           just DNA sequence characters

reverse_complement_as_string

 Title   : reverse_complement_as_string
 Usage   : $string = reverse_complement_as_string($seq_or_string_scalar)
 Function: reverse complements a string or sequence argument
           producing a string
 Returns : A string of DNA letters
 Args    : Either a sequence object or a string of
           just DNA sequence characters

revcom_as_string

 Title   : revcom_as_string
 Usage   : $string = revcom_as_string($seq_or_string_scalar)
 Function: reverse complements a string or sequence argument
           producing a string
 Returns : A string of DNA letters
 Args    : Either a sequence object or a string of
           just DNA sequence characters

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

FEEDBACK

Mailing lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.

  bioperl-l@bioperl.org               - General discussion
  https://bioperl.org/Support.html    - About the mailing lists

Support

Please direct usage questions or support issues to the mailing list: bioperl-l@bioperl.org rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Reporting bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the web:

  https://github.com/bioperl/bio-procedural/issues

AUTHOR

Ewan Birney <birney@ebi.ac.uk>

COPYRIGHT

This software is copyright (c) by many people (see the individual modules for their copyright holders).

This software is available under the same terms as the perl 5 programming language system itself.

2026-08-21 perl v5.42.3