| Bio::DB::Bam::Alignment(3pm) | User Contributed Perl Documentation | Bio::DB::Bam::Alignment(3pm) |
NAME¶
Bio::DB::Bam::Alignment -- The SAM/BAM alignment object
SYNOPSIS¶
use Bio::DB::Sam;
my $sam = Bio::DB::Sam->new(-fasta=>"data/ex1.fa",
-bam =>"data/ex1.bam");
my @alignments = $sam->get_features_by_location(-seq_id => 'seq2',
-start => 500,
-end => 800);
for my $a (@alignments) {
my $seqid = $a->seq_id;
my $start = $a->start;
my $end = $a->end;
my $strand = $a->strand;
my $ref_dna= $a->dna;
my $query_start = $a->query->start;
my $query_end = $a->query->end;
my $query_strand = $a->query->strand;
my $query_dna = $a->query->dna;
my $cigar = $a->cigar_str;
my @scores = $a->qscore; # per-base quality scores
my $score = $a->qstring; # TAM-style quality string
my $match_qual= $a->qual; # quality of the match
my $paired = $a->get_tag_values('PAIRED');
}
DESCRIPTION¶
The Bio::DB::Bam::Alignment and Bio::DB::Bam::AlignWrapper classes together represent an alignment between a sequence read (the "query") and a reference sequence (the "target"). Bio::DB::Bam::Alignment adheres strictly to the C-level BAM library's definition of a bam1_t* and is used in the Bio::DB::Sam low-level API The latter adds convenience methods that make it similar to a BioPerl Bio::SeqFeatureI object. This manual page describes both.
High-level Bio::DB::Bam::Alignment methods¶
These methods are provided by Bio::DB::Bam::Alignment, and are intended to be compatible with the Bio::SeqFeatureI interfaces. Note that these objects are not compatible with Bio::Align::AlignI, as the BAM API is fundamentally incompatible with the BioPerl API for alignments (the first deals with the alignment of a single read against the reference sequence, while the second deals with a multiple alignment).
Note that the high-level API return Bio::DB::Bam::AlignWrapper objects except in the case of the callback to the fast_pileup() method. In this case only, the object returned by calling $pileup->b() is a Bio::DB::Bam::Alignment object for performance reasons.
- $seq_id = $align->seq_id
- Return the seq_id of the reference (target) sequence. This method is only available in the Bio::DB::Bam::AlignWrapper extension.
- $start = $align->start
- Return the start of the alignment in 1-based reference sequence coordinates.
- $end = $align->end
- Return the end of the alignment in 1-based reference sequence coordinates.
- $len = $align->length
- Return the length of the alignment on the reference sequence.
- $mseqid = $align->mate_seq_id
- Return the seq_id of the mate's reference (target) sequence. This method is only available in the Bio::DB::AlignWrapper extension.
- $mstart = $align->mate_start
- For paired reads, return the start of the mate's alignment in 1-based reference sequence coordinates.
- $mend = $align->mate_end
- For paired reads, return the end position of the mate's alignment in 1-based reference sequence coordinates.
- $mlen = $align->mate_len
- For mate-pairs, retrieve the length of the mate's alignment on the reference sequence.
- $strand = $align->strand
- Return the strand of the alignment as -1 for reversed, +1 for forward.
NOTE: In versions 1.00-1.06, this method always returned +1. As of version 1.07, this behavior is fixed.
- $mstrand = $align->mstrand
- If the read has a mate pair, return the strand of the mate in the format -1 or +1.
- $ref_dna = $align->dna
- Returns the reference sequence's DNA across the aligned region. If an MD tag is present in the alignment, it will be used preferentially to reconstruct the reference sequence. Otherwise the reference DNA access object passed to Bio::DB::Sam->new() will be used.
- $ref_dna = $align->seq
- The reference sequence's DNA as a Bio::PrimarySeqI object (useful for passing to BioPerl functions and for calculating subsequences and reverse complements).
- $query = $align->query
- This method returns a Bio::DB::Alignment::Query object that can be used to retrieve information about the query sequence. The next few entries show how to use this object.
- $read_name = $align->query->name
- The name of the read.
- $q_start = $align->query->start
- This returns the start position of the query (read) sequence in 1-based coordinates. It acts via a transient Bio::DB::Bam::Query object that is provided for Bio::Graphics compatibility (see Bio::Graphics).
- $q_end = $align->query->end
- This returns the end position of the query sequence in 1-based coordinates.
- $q_len = $align->query->length
- Return the length of the alignment on the read.
- $scores = $align->query->score
- Return an array reference containing the unpacked quality scores for each base of the query sequence. The length of this array reference will be equal to the length of the read.
- $read_dna = $align->query->dna
- The read's DNA string.
- $read_seq = $align->query->seq
- The read's DNA as a Bio::PrimarySeqI object.
- $target = $align->target;
- The target() method is similar to query(), except that it follows Bio::AlignIO conventions for how to represent minus strand alignments. The object returned has start(), end(), qscore(), dna() and seq() methods, but for minus strand alignments the sequence will be represented as it appears on the reverse strand, rather than on the forward strand. This has the advantage of giving you the read as it came off the machine, before being reverse complemented for use in the SAM file.
- $query = $align->hit
- The hit() method is identical to target() and returns information about the read. It is present for compatibility with some of the Bio::Graphics glyphs, which use hit() to represent the non-reference sequence in aligned sequences.
- $primary_id = $align->primary_id
- This method synthesizes a unique ID for the alignment which can be passed to $sam->get_feature_by_id() to retrieve the alignment at a later date.
- @tags = $align->get_all_tags
- Return all tag names known to this alignment. This includes SAM flags such as M_UNMAPPED, as well as auxiliary flags such as H0. The behavior of this method depends on the value of -expand_flags when the SAM object was created. If false (the default), then the standard SAM flags will be concatenated together into a single string and stored in a tag named 'FLAGS'. The format of this tag value is the list of one or more flag constants separated by the "|" character, as in: "PAIRED|MAP_PAIR|REVERSED|SECOND_MATE". If -expand_flags was true, then each flag becomes its own named tag, such as "MAP_PAIR".
- @values = $align->get_tag_values($tag)
- Given a tag name, such as 'PAIRED' or 'H0', return its value(s). -expand_flags must be true in order to use the standard SAM flag constants as tags. Otherwise, they can be fetched by asking for the "FLAGS" tag, or by using the low-level methods described below.
- $is_true = $align->has_tag($tag)
- Return true if the alignment has the indicated tag.
- $string = $align->cigar_str
- Return the CIGAR string for this alignment in conventional human readable format (e.g. "M34D1M1").
- $arrayref = $align->cigar_array
- Return a reference to an array representing the CIGAR string. This is an
array of arrays, in which each subarray consists of a CIGAR operation and
a count. Example:
[ ['M',34], ['D',1], ['M1',1] ] - ($ref,$matches,$query) = $align->padded_alignment
- Return three strings that show the alignment between the reference
sequence (the target) and the query. It will look like this:
$ref AGTGCCTTTGTTCA-----ACCCCCTTGCAACAACC $matches |||||||||||||| ||||||||||||||||| $query AGTGCCTTTGTTCACATAGACCCCCTTGCAACAACC - $str = $align->aux
- Returns the text version of the SAM tags, e.g. "XT:A:M NM:i:2 SM:i:37 AM:i:37 XM:i:1 XO:i:1 XG:i:1 MD:Z:6^C0A47"
- $str = $align->tam_line
- Returns the TAM (text) representation of the alignment (available in the high-level "AlignWrapper" interface only).
- $tag = $align->primary_tag
- This is provided for Bio::SeqFeatureI compatibility. Return the string "match".
- $tag = $align->source_tag
- This is provided for Bio::SeqFeatureI compatibility. Return the string "sam/bam".
- @parts = $align->get_SeqFeatures
- Return subfeatures of this alignment. If you have fetched a "read_pair" feature, this will be the two mate pair objects (both of type Bio::DB::Bam::AlignWrapper). If you have -split_splices set to true in the Bio::DB::Sam database, calling get_SeqFeatures() will return the components of split alignments. See "Bio::DB::Sam Constructor and basic accessors" in Bio::DB::Sam for an example of how to use this.
Low-level Bio::DB::Bam::Alignment methods¶
These methods are available to objects of type Bio::DB::Bam::Alignment as well as Bio::DB::Bam::AlignWrapper and closely mirror the native C API.
- $align = Bio::DB::Bam::Alignment->new
- Create a new, empty alignment object. This is usually only needed when iterating through a TAM file using Bio::DB::Tam->read1().
- $tid = $align->tid( [$new_tid] )
- Return the target ID of the alignment. Optionally you may change the tid by providing it as an argument (currently this is the only field that you can change; the functionality was implemented as a proof of principle).
- $read_name = $align->qname
- Returns the name of the read.
- $pos = $align->pos
- 0-based leftmost coordinate of the aligned sequence on the reference sequence.
- $end = $align->calend
- The 0-based rightmost coordinate of the aligned sequence on the reference sequence after taking alignment gaps into account.
- $len = $align->cigar2qlen
- The length of the query sequence calculated from the CIGAR string.
- $quality = $align->qual
- The quality score for the alignment as a whole.
- $flag = $align->flag
- The bitwise flag field (see the SAM documentation).
- $mtid = $align->mtid
- For paired reads, the target ID of the mate's alignment.
- $mpos = $align->mpos
- For paired reads, the 0-based leftmost coordinate of the mate's alignment on the reference sequence.
- $n_cigar = $align->n_cigar
- Number of CIGAR operations in this alignment.
- $length = $align->l_qseq
- The length of the query sequence (the read).
- $dna = $align->qseq
- The actual DNA sequence of the query. As in the SAM file, reads that are aligned to the minus strand of the reference are returned in reverse complemented form.
- $score_str = $align->_qscore
- A packed binary string containing the quality scores for each base of the read. It will be the same length as the DNA. You may unpack it using unpack('C*',$score_str), or use the high-level qscore() method.
- $score_arry = $align->qscore
- @score_arry = $align->qscore
- In a scalar context return an array reference containing the unpacked quality scores for each base of the query sequence. In a list context return a list of the scores. This array is in the same orientation as the reference sequence.
- $score_str = $align->qstring
- Returns the quality string in the same format used in the SAM (TAM) file.
- $length = $align->isize
- The calculated insert size for mapped paired reads.
- $length = $align->l_aux
- The length of the align "auxiliary" data.
- $value = $align->aux_get("tag")
- Given an auxiliary tag, such as "H0", return its value.
- @keys = $align->aux_keys
- Return the list of auxiliary tags known to this alignment.
- $data = $align->data
- Return a packed string containing the alignment data (sequence, quality scores and cigar string).
- $length = $align->data_len
- Return the current length of the alignment data.
- $length = $align->m_data
- Return the maximum length of the alignment data.
- $is_paired = $align->paired
- Return true if the aligned read is part of a mate/read pair (regardless of whether the mate mapped).
- $is_proper = $align->proper_pair
- Return true if the aligned read is part of a mate/read pair and both partners mapped to the reference sequence.
- $is_unmapped = $align->unmapped
- Return true if the read failed to align.
- $mate_is_unmapped = $align->munmapped
- Return true if the read's mate failed to align.
- $reversed = $align->reversed
- Return true if the aligned read was reverse complemented prior to aligning.
- $mate_reversed = $align->mreversed
- Return true if the aligned read's mate was reverse complemented prior to aligning.
- $isize = $align->isize
- For mate-pairs, return the computed insert size.
- $arrayref = $align->cigar
- This returns the CIGAR data in its native BAM format. You will receive an
arrayref in which each operation and count are packed together into an
8-bit structure. To decode each element you must use the following
operations:
use Bio::DB::Sam::Constants; my $c = $align->cigar; my $op = $c->[0] & BAM_CIGAR_MASK; my $len = $c->[0] >> BAM_CIGAR_SHIFT;
SEE ALSO¶
Bio::Perl, Bio::DB::Sam, Bio::DB::Bam::Constants
AUTHOR¶
Lincoln Stein <lincoln.stein@oicr.on.ca>. <lincoln.stein@bmail.com>
Copyright (c) 2009-2015 Ontario Institute for Cancer Research.
This package and its accompanying libraries are free software; you can redistribute it and/or modify it under the terms of the Artistic License 2.0, the Apache 2.0 License, or the GNU General Public License (version 1 or higher). Refer to LICENSE for the full license text.
| 2026-07-23 | perl v5.42.2 |