NAME¶
mlv-smile - inference of structured signals in multiple sequences
SYNOPSIS¶
mlv-smile <parameter_file>
mlv-smile [-g number]
DESCRIPTION¶
This manual page documents briefly the
mlv-smile command. For more
details and example, you should have a look to the
documentation files
installed with it.
mlv-smile is a program that was primarily made to extract promoter
sequences from DNA sequences. The interest of this program is to infer
simultaneously several motifs (called boxes) that respects distance
constraints. The user has to write in a
parameter_file the list of
criteria that he wants the signal to respect. In a first step of extraction,
all signals respecting these criteria are found. In a second step, they are
all statistically evaluated, aiming to detect the ones that are exceptionally
represented in the original sequences. Since the 1.4 version
mlv-smile
allows one to extract such signals on any alphabet in any kind of sequences.
OPTIONS¶
The program usually waits for a parameter file that contains all the criteria
needed. The only option is:
- -g number
- produces on the standard output a generic parameter file to
extract number boxes signals.
HOW TO¶
How to use mlv-smile?¶
The only command you'll use is 'mlv-smile'. You have to give it just one
parameter, which is the name of a parameters file which should contain the
characteristics of the motifs you want to extract.
How to start?¶
You first have to write an alphabet file, which contains the alphabet used to
describe the motifs. Then you have to write a parameter file, and you're ready
to use mlv-smile.
What should I write in the alphabet file?¶
The first line should contain the type of the alphabet's elements, to choose
between "Nucleotides", "Proteins", or "Others".
This is to allow mlv-smile to change, for instance, the "A or G"
symbol into an R in DNA sequences. Then, on each line, you have to write the
elements of the motifs's alphabet.
Example: if you want to extract simple motifs (A,C,G,T) from clean DNA
sequences written with a four letters alphabet (A,C,G,T), then you may write
an alphabet file containing:
Type:Nucleotides
A
C
G
T
Let's call this file 'alpha'.
How to write a simple parameter file?¶
You have to first write an alphabet file. You also need a sequence file, at the
FASTA format. Then, you can create a parameter file, using the "mlv-smile
-g number_of_boxes" command to help you.
Example: Let's write a parameter file to extract simple motifs. If you
don't already have one, let's first create a small DNA file in FASTA format,
containing several sequences:
> Seq A
AGGCTAGTCAGGGCATGCGATCAGCAGGCATCAGGCGAGCATCGACAGCA
> Seq B
GGAGAGCGCAGAGCGAGCATCATCATGCAGCATCAGAGATCTTTCT
Let's call this file 'seq'.
Our purpose is now to extract from these sequences all motifs of length 13 that
appears at least one time in 100% of the sequences, allowing one substitution.
We may write the following parameter file (helped with the 'mlv-smile -g 1'
command):
FASTA file seq // previously created
Output file results
Alphabet file alpha //previously created
Quorum 100
Total min length 13
Total max length 13
Total substitutions 1
Boxes 1
Let's call this file 'param'.
You can launch "mlv-smile" after having created the alphabet and
parameter files.
Example: With the previous alphabet, sequences and parameter files, you
can now launch mlv-smile: "mlv-smile param". You will obtain the
following motifs in the "results" file:
GCGAGCATCAACA 2120210310010 2
Seq 1 Pos 12
Seq 0 Pos 34
2
GCGAGCATCGTCA 2120210312310 2
Seq 1 Pos 12
Seq 0 Pos 34
2
The first motif found, GCGAGCATCAACA, appears at position 12 in the second
sequence and position 34 in the first one (all positions or sequences counts
starts at zero).
How to evaluate the significance of the motifs found?¶
You have to add some evaluation lines at the end of the parameter file.
Example: At the bottom of the previous "param" parameter file,
you can add:
Shufflings 100
Size k-mer 2
which means that the original sequences will be shuffled 100 times, conserving
dinucleotides. The significance of the motifs found previously will be
computed from their frequency of apparition in the shuffled sequences. The
more number of shuffling you do, the more stable are the results, but it's
longer to compute.
For this example, you may find such results (in the
"results.shuffle"):
STATISTICS ON THE NUMBER OF SEQUENCES HAVING AT LEAST ONE OCCURRENCE
Model %right #right %shfl. #shfl. Sigma Chi2 Z-score
==============================================================
GCGAGCATCGTCA 100.00% 2 0.50% 0.01 0.10 3.96 19.90
GCGAGCATCAACA 100.00% 2 1.00% 0.02 0.14 3.92 14.07
STATISTICS ON THE TOTAL NUMBER OF OCCURRENCES
Model #right #shfl. Sigma Chi2 Z-score
=======================================================
GCGAGCATCGTCA 2 0.01 0.10 1.99 19.90
GCGAGCATCAACA 2 0.02 0.14 1.96 14.07
The first block of results shows the statistics on the number of sequences
having at least one occurrence. You can read, for each motif found, the
frequency of apparition in the original and shuffled sequences, and two
statistical scores (Chi2 and Z-score) deduced. Motifs are sorted according to
the highest Z-scores. A high Z-score means that the motif appears in a
surprising way in the original sequences.
The parameter file should be modified to indicate the characteristics of the
structured motifs to infer. You have to write global parameters for the whole
motif, and local parameters for each box of it.
Example: Let's extract from the previous "seq" sequences
structured motifs composed of 2 boxes of length 5 to 6, but the whole motif
must have a length 11. The two boxes may be separated by 10 to 15 nucleotides.
You allow at most one substitution in each box, and at least one occurrence of
a motif must appear in 100% of the sequences, you may write the following
parameter file:
FASTA file seq
Output file results
Alphabet file alpha
Quorum 100
Total min length 11
Total max length 11
Total substitutions 2
Boxes 2
BOX 1 ================
Min length 5
Max length 6
Substitutions 1
Min spacer length 10
Max spacer length 15
BOX 2 ================
Min length 5
Max length 6
Substitutions 1
PARAMETER FILE CRITERIA¶
- FASTA File <filename>
- The name of the file which contains the sequences to use
for inference. These sequences must be at the FASTA format. This file must
contain at least two sequences, as you cannot detect motifs which are
common to several sequences in one sequence!
- Output file <filename>
- The name of the file where results of extraction will be
written.
- Alphabet file <filemane>
- The name of the file where you have to tell mlv-smile on
which alphabet it will infer motifs. The first line of this file contains
"Type:" followed by the type of symbols you use, to choose
between "Nucleotides", "Proteins" or
"Others". Then, on each line of the file, must be written the
symbols of the sequence that may be matched by a symbol of a motif. A line
containing "ANR" means that there is a symbol in the motif's
alphabet which matches A, N or R in the sequences. If Type is defined with
Nucleotides, mlv-smile will change this ANR symbol into an A to make it
more readable. These associations will be printed at the beginning of the
execution.
- Quorum <number>
- The percentage of sequences where at least one occurrence
of a motif must appear to make it valid. 100 means that a motif must have
occurrences in every sequences.
- Total min length <number>
- The minimal length of the whole motif, i.e. the sum of
minimal lengths of each box. Warning: the length of the gaps between boxes
mustn't me taken into account. The total minimal length may differ of the
sum of boxs's minimal length: you can, for instance, infer motifs made of
two boxes, with min length of boxes equals to 4 and a total min length
equals to 10.
- Total max length <number>
- Same explanation as "Total min length", excepted
that a 0 length means "infinity".
- Total substitutions <number>
- Total maximum number of substitutions for the whole motif.
As for the total length, this is not necessarily the sum of each box's
substitution number.
- Boxes <number>
- The number of boxes that compose the motifs to infer. When
inferring simple one box motifs, it's not necessary to use local criteria
as global and local criteria will be the same.
- Composition in <symbol> <number>
[OPTIONAL]
- The number of a given symbol of the motif's alphabet may be
restrained to a maximum by this criteria.
- BOX <number>
- Begin the description of the criteria of a given box of the
motif.
- Min length <number>
- Minimum length for the current box.
- Max length <number>
- Same explanation as "Min length", excepted that a
0 length means "infinity".
- Substitution <number>
- Maximum number of substitutions allowed for the current
box.
- Composition in <symbol> <number>
[OPTIONAL]
- Same as the global composition, but for the current box.
- Min spacer length <number>
- Minimum number of symbols between the end of the current
box and the beginning of the next one. This parameter mustn't appear in
the last box's criteria, which has no next box!
- Max spacer length <number>
- Same explanation as "Max spacer length".
- Delta <number> [OPTIONAL]
- This criteria allows one to infer motifs composed of
several boxes without really knowing the distance between these boxes. The
min and max spacer length will be used as a "large" interval,
and the delta's value will define the size of small intervals into this
large one. An inference of two boxes motifs with a [10-20] range of
distance between the boxes will produce motifs whose occurrences respect
this range. A "Delta" criteria fixed to 2, for instance, will
realize the same inference in all the possible ranges [i-delta, i+delta]
(here: [10-14], [11-15], ...). As many output files as different ranges
will be produced.
- Palindrome of box <number> [OPTIONAL]
- Indicate that the concerned box must be the biological
palindrome of one of the previous boxes.
- Shufflings <number> [OPTIONAL]
- The number of shufflings of the original sequences to
realize for the evaluation of the statistical significance of the motifs
found.
- Size k-mer <number> [OPTIONAL, always with
shuffling]
- Length of the words to conserve during shufflings (usually
2).
- Against wrong sequences <filename>
[OPTIONAL]
- Another method to evaluate the significance of the motifs
(not compatible with the shuffling method). In the case where you have a
sequence file where you believe that the motifs you look for in the first
sequences set won't appear, you can give to mlv-smile such a sequence
file. The statistical evaluation of motifs found will be made by computing
theit frequency in the "wrong sequences".
WARNING¶
mlv-smile is an exact combinatorial algorithm. It is not made to infer any kind
of motifs. The amount of data where the extraction is made can be very large,
but some criteria (in particular the number of substitutions) must be
restrained to reasonable values: one or two substitutions allowed in a 10
length motif is ok, but not 6 or 8 substitutions. The notion of spacers is
made to avoid the use of to much substitutions.
BUGS¶
A bug has been found in the 1.46 version, which could generate wrong results in
some particular cases. In particular, results may be wrong for incoherent
length criteria. There are still probably a lot of bugs in mlv-smile. This
1.47 version is quite stable, but do not hesitate to report any bug to
<lama AT prism.uvsq DOT fr>.
SEE ALSO¶
This software has been implemented from an algorithm proposed in
L. Marsan and M.-F. Sagot, Algorithms for extracting structured motifs using
a suffix tree with application to promoter and regulatory site
consensus identification", J. of Comput. Biol. 7, 2001,
345-360
You should refer to these paper for algorithmic details. If bored by such
things, just notice that the extraction step of
mlv-smile is exact,
which means that all motifs respecting the given criteria are found. Please
quote this article if you produce some results given by
mlv-smile.
For some examples of applications we made on biological datas (with good
results), refer to
A. Vanet and L. Marsan and M.-F. Sagot,"Promoter sequences and
algorithmically methods for identifying them", Research in
Microbiology 150, 1999, 779-799
and
A. Vanet and L. Marsan and A. Labigne and M.-F. Sagot, Inferring
regulatory elements from a whole genome. An application to the analysis
of genome of Helicobacter Pylori Sigma 80 family of promoter
signals", J. Mol. Biol. 297, 2000, 335-353
AUTHOR¶
This manual page was written by Laurent Marsan <lama AT prism.uvsq DOT
fr>, for the Debian GNU/Linux system (but may be used by others).